FUTUREWAVE & 36 CYPHER - Hell Sweet Home LP (via FXCK RXP) COMING SOON

2021.11.29 07:47 1909_SGD FUTUREWAVE & 36 CYPHER - Hell Sweet Home LP (via FXCK RXP) COMING SOON

FUTUREWAVE & 36 CYPHER - Hell Sweet Home LP (via FXCK RXP) COMING SOON submitted by 1909_SGD to AlbumArtPorn [link] [comments]


2021.11.29 07:47 Diopod136 Entry 10 - 29 Nov 11:00

Jesus Christ. I found a pornstar that looks 100% like my best friend/long time crush. This is going to be fun
She’s got the same height around, face shape, eyes, hair colour and length and even her glasses are the same colour.
I want her to suck my dick then mount me and ride me to oblivion in just a pleated skirt
submitted by Diopod136 to MasturbationJournal [link] [comments]


2021.11.29 07:47 melancoluxx Blast multiple sequences at once with NCBI blastn

Hi all,
I am designing pool of probes for fluorescent HCR in situ hybridization. I use blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) to check the specificity of each probe by entering for instance "GACATTTACTTATGTGCAGAGAAAC XX CAATTTCCACGGACGCACTGACGTG" as the query and Mus Musculus as the Search Set.
I usually do it one by one but for a specific gene I end up with almost 200 pair of probes to check and would like to blast them all at once. Is there a way to do it on the cited website? I already tried to upload a file with all the probes as the query but it only blasted the first sequence of the list.
Thanks!
submitted by melancoluxx to bioinformatics [link] [comments]


2021.11.29 07:47 drynionph ⚡ Wanamoon BSC Token | ⚡ Launching Now on BSC | ownership renounced | $40k Jackpot Draw Today | Unique Tokenomics | Active Community in Telegram | Don't Miss This x100 Potential Gem



WELCOME TO A NEW BSC MOONSHOT EXPERIENCE… WANAOON? THEN MOON WITH US! ⚡

☘︎ JACKPOT DRAW TODAY OVER $40K ☘︎
WANAMOON is a new token that rewards holders and new buyers with the opportunity to be entered in to a weekly JACKPOT draws! 50% of the jackpot goes to one holder paid in BUSD. The other 50% will be used to buy one of the hottest meme token of the week and distributed proportionately to qualified holders. You goto be in it to win it! Initially launching on BSC Blockchain, Wana Moon will then rapidly expand to other blockchains including ETH very soon!

Contract Address: 0x460042aF78f77f44A39c2b0378A35D95fEb9FD7C

TL;DR ⚙️
⁃ Weekly Jackpot Token, first draw takes place
⁃ WanaMoon Contract Fully Audited by SolidProof
⁃ Team Fully Doxxed & KYC Verified
⁃ Liquidity will be locked
⁃ Full Dapp Release on Launch to track Jackpot Entires and Total Worth
⁃ Full Detailed aggressive marketing plan
⁃ BIG Token Partnerships in talks
⁃ Team with a detailed roadmap plan of execution

⚔️ TOKENOMICS - 10% TAX ON ALL TRANSACTIONS
⁃ 1% reflection to all holders
⁃ 2% Weekly jackpot
⁃ 3% Buyback and auto liquify
⁃ 4% Marketing

Contract Address: 0x460042aF78f77f44A39c2b0378A35D95fEb9FD7C
✨Pinksale Locked
https://www.pinksale.finance/#/pinklock/record/4097?chain=BSC

✨ PANCAKESWAP
https://pancakeswap.finance/swap?outputCurrency=0x460042aF78f77f44A39c2b0378A35D95fEb9FD7C


LINKS TO OFFICIAL CHANNELS
⛓️ Website: https://wanamoon.in/
✉️ Telegram: https://t.me/WanaMoonOfficial
⚽ Twitter: https://twitter.com/WanaMoonOffical
submitted by drynionph to CryptoCurrencyTrading [link] [comments]


2021.11.29 07:47 justelle1 How can i prevent the Mac from switching mic when connecting a bluetooth headset?

As the title says, i need to disable permanently the hands-free mode on my headphones, not only because it switches in SBC when using a mic app (like Webex) forcing me to change every time the audio from "System preferences" is there any way to do this?
submitted by justelle1 to MacOS [link] [comments]


2021.11.29 07:47 PotatoFighter123 Why the fuck are ads on porn websites are so weird?

submitted by PotatoFighter123 to NoStupidQuestions [link] [comments]


2021.11.29 07:47 muyy_mala [Task] looking for artist to make Digital art avatar/portrait of myself. $50

Hello, I'm needing an avata portrait of myself. I am wanting to use it as my profile picture on different social media sites ( such as Instagram, Twitter & OF)! I want it to be cartoon mixed with pinup style. I'm flexible on whether it is full body or just portrait. If we agree on full body I do have tattoos I'd love to be incorporated into it. I only can pay via cashapp. Looking for something sooner than later ( next few days). I'd also need to see some sort of portfolio to make sure you have the style I'm looking for.
Please DM me through here to discuss further. Only can pay via cashapp! Thank you.
submitted by muyy_mala to slavelabour [link] [comments]


2021.11.29 07:47 ClydeinLimbo I can’t find a subreddit closer to Liphook but I hope you kind people can share this for me. Please please please

I can’t find a subreddit closer to Liphook but I hope you kind people can share this for me. Please please please submitted by ClydeinLimbo to guildford [link] [comments]


2021.11.29 07:47 HKnational British MPs call for law changes to help young Hongkongers flee to UK

British MPs call for law changes to help young Hongkongers flee to UK submitted by HKnational to unitedkingdom [link] [comments]


2021.11.29 07:47 Tiniest_ATINY Can the other side of my video call hear my stomach growling?

I have Colitis so my stomach growls a lot. I have video calls every day, my mic is on my desk. Can the other person hear me?
submitted by Tiniest_ATINY to NoStupidQuestions [link] [comments]


2021.11.29 07:47 Spalla42 Two Matches at the same day?

Hi everyone; this saturday i have the playoff match at 12:00 BUT i also have a friendly match at 11:00. Never happened to me and i think it's not quite regular. What should i do? (Obviously, i will deploy my best team for the playoff)
submitted by Spalla42 to hattrick [link] [comments]


2021.11.29 07:47 MF4242 Gift Pocket Watch DIY Kit

Hi Folks, I have a friend who I want to buy a DIY, build it yourself, pocket watch for Christmas. Its something he has talked about for ages so its the perfect gift for him. But I don't have the first clue about pocket watches or DIY kits for them. I am looking for something that is intermediate in difficulty and rustic in styling or has some detailing. Does anyone have any good links/sites/advice that would help me get this ? Ordering from the UK
submitted by MF4242 to pocketwatch [link] [comments]


2021.11.29 07:47 reddit_for_stuff Game is unplayable right now

All the pack addicts are breaking the servers it seems like. Can't tell the difference between 97 Pace, 99 Agility Gelson and 55 Pace, 64 Agility Kroos and defending is literally impossible as every player is stuck in mud.
submitted by reddit_for_stuff to fut [link] [comments]


2021.11.29 07:47 3amthoughts-- What is the most disturbing thing anyone has asked you?

submitted by 3amthoughts-- to AskReddit [link] [comments]


2021.11.29 07:47 ArchimedesGeeks [Prototype&Feedback Request] Idle Spiral


https://preview.redd.it/g207l0z3li281.png?width=2858&format=png&auto=webp&s=593d80d316ebfee652c1ab81d143d65760244023
Game Link : https://archimedesgeeks.itch.io/idle-spiral
Discotd : https://discord.gg/y4J8U78UA8

Hello, we are "Archimedes Geeks", a team of Japanese game developerswho like mathematics very much.!

We tried to combine the mystery of mathematics with the mystery of incremental games in our game "Idle Spiral". The game is based on the "Spiral", and your goal is to extend the spiral as far as possible. We were very inspired by "Exponential Idle" in creating this game, but we made a lot of efforts to make this game very unique.There is a lot of math involved, but the upgrades themselves are hardly strategic. Also, they too will eventually be automated!

This game is a prototype, so we'd like to get a lot of feedback from you. In particular, if you have any ideas for new mechanics or upgrades, I'd love to hear them. The game is currently intentionally balanced to be finished in 2~3 hours so that you can easily finish the content.

Brief instruction of how to play
- In the upper left corner of the screen, you can see the current distance of the spiral. The goal is to increase this as many times as possible. You can also use this distance as currency.
- Click on the white frame below to see the upgrades. By buying these upgrades, you can extend the spiral farther.
- As you progress through the game, you will be able to prestige, which will reset the game (as I'm sure you know), but allow you to start stronger.

I hope you all enjoy this game!
submitted by ArchimedesGeeks to incremental_games [link] [comments]


2021.11.29 07:47 Best_Perspective_182 My former boss who I haven't worked for since early 2019 falsely reported to the HMRC (UK) that he paid me in the year 2020/21 April

I need some advice on what to do. He falsely reported that he paid me a small amount of money (>£100), so I'm unsure weather it will be taken seriously. Also, are companys allowed to keep our information for so long after we have left?
He was the owner of a 0 hour contract agency, and he was the worst person I've ever worked for, he treated all his staff like shit, paid us minimum wage, and eventually fired me because I was too sick to attend a shift (even though I was on a 0 hour contract and he would always cancel our shifts whenever he pleased).
There was a rumour that he had previously been in trouble for fraud. He sent us all a text message telling us the rumours were false and anyone caught speaking about it would be fired. He said that if we continued speaking about it he might loose his contract with companies, which would also be bad for us 🙄.
submitted by Best_Perspective_182 to antiwork [link] [comments]


2021.11.29 07:47 MrFoozOG So you Pre-Purchased a game that was sold as finished but is in Fact still in Alpha?

And you're not even angry about it?
Imagine, going to the store, buying a TV and when delivered at your home it arrives without box, the screen is scratched, the housing is nonexistent, the remotes buttons only work half the time and the circuit board is falling out. But at least you can watch TV, so it's all good right?

I don't understand why the average person just gobbles up todays SCAM games.. They're entirely unfinished, underdelivered and have tons of false promises/lies about them.
yet it keeps getting worse and worse and yet you keep pre purchasing. WHY?
So you can have that dumb ass skin that everyone will get at level 10? So you have 3 days advantage over the average player? Why Pre purchase?
All you do is shove your money into a pile of shit that was sold as a 500karat diamond..
and you be like 'oh well, a few updates and 1 or 2 years later will fix it' how is this acceptable to you??
If you want to see drastic changes about AAA releases, you need to QUIT purchasing entirely.
Wait it out... you don't need to play it on release day to streamsnipe your favorite streamer.. They don't even care about you.
For the love of god.
submitted by MrFoozOG to battlefield2042 [link] [comments]


2021.11.29 07:47 AutoNewspaperAdmin [Top Stories] - Omicron: Australia pauses next phase of border reopening | BBC

[Top Stories] - Omicron: Australia pauses next phase of border reopening | BBC submitted by AutoNewspaperAdmin to AutoNewspaper [link] [comments]


2021.11.29 07:47 Minute-Capital-418 God's Own Country

God's Own Country submitted by Minute-Capital-418 to iPhoneography [link] [comments]


2021.11.29 07:47 HiMiru Tornyai János kijelölte saját útját, aszerint élt és alkotott

submitted by HiMiru to Hodmezovasarhely [link] [comments]


2021.11.29 07:47 AutoNewspaperAdmin [Top Stories] - Snowed in at Britain's highest pub for three nights | BBC

[Top Stories] - Snowed in at Britain's highest pub for three nights | BBC submitted by AutoNewspaperAdmin to AutoNewspaper [link] [comments]


2021.11.29 07:47 RemarkableAlarm4172 Works reasonable accommodation

Hey,
Just a bit of a quick one really.
I got a job out of Uni while everyone was working from home. We have now started moving to a hybrid approach with a few days in office where each team goes in on different days. However, we've been told that if we can't go into the office we cannot work from home.
I have medical conditions that can make it hard to get around some times. Such as major fatigue, migraines or terrible joint instability and pain. I've been told that even though I am willing to work from home on the days where it is an issue that I would not be allowed and would have to take a sick day. Is there anything I can do about this? When I joined they said they would make any reasonable accommodations for me to do my job. I'm a software engineer so being in the office does to really change by ability to perform my role.
Help would be appreciated, my job (and office) is England , I live in Wales.
submitted by RemarkableAlarm4172 to LegalAdviceUK [link] [comments]


2021.11.29 07:47 Kitchen-Conflict-529 Продается дом в станице Каневской Краснодарского края, переезд на пмж в ...

Продается дом в станице Каневской Краснодарского края, переезд на пмж в ... submitted by Kitchen-Conflict-529 to arbolityug [link] [comments]


2021.11.29 07:47 yashkumarverma NASA is debian! from earthobservatory.nasa.gov map

NASA is debian! from earthobservatory.nasa.gov map submitted by yashkumarverma to debianinrandomplaces [link] [comments]


2021.11.29 07:47 xtastydestroyer Now orange

Now orange submitted by xtastydestroyer to DarkViperAU [link] [comments]


http://avenutur.ru